|
MedChemExpress
necrostatin 1 Necrostatin 1, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/necrostatin 1/product/MedChemExpress Average 96 stars, based on 1 article reviews
necrostatin 1 - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
TargetMol
necrostatin 1 Necrostatin 1, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/necrostatin 1/product/TargetMol Average 93 stars, based on 1 article reviews
necrostatin 1 - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
sirt2 Sirt2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sirt2/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
sirt2 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
necrostatin 1 nec 1 Necrostatin 1 Nec 1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/necrostatin 1 nec 1/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
necrostatin 1 nec 1 - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
AnaSpec
g2ct ![]() G2ct, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/g2ct/product/AnaSpec Average 90 stars, based on 1 article reviews
g2ct - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
AnaSpec
reverse aβ 42-1 as-27276 ![]() Reverse Aβ 42 1 As 27276, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse aβ 42-1 as-27276/product/AnaSpec Average 90 stars, based on 1 article reviews
reverse aβ 42-1 as-27276 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Bachem
selective par-1 agonist tfllr-amide tfllr-nh 2 ![]() Selective Par 1 Agonist Tfllr Amide Tfllr Nh 2, supplied by Bachem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/selective par-1 agonist tfllr-amide tfllr-nh 2/product/Bachem Average 90 stars, based on 1 article reviews
selective par-1 agonist tfllr-amide tfllr-nh 2 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Bachem
grgesp peptides ![]() Grgesp Peptides, supplied by Bachem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/grgesp peptides/product/Bachem Average 90 stars, based on 1 article reviews
grgesp peptides - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Genotech Corp
control odn 1720 (tccatgagcttcctgatgct, inactive control for cpg odn 1668) ![]() Control Odn 1720 (Tccatgagcttcctgatgct, Inactive Control For Cpg Odn 1668), supplied by Genotech Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/control odn 1720 (tccatgagcttcctgatgct, inactive control for cpg odn 1668)/product/Genotech Corp Average 90 stars, based on 1 article reviews
control odn 1720 (tccatgagcttcctgatgct, inactive control for cpg odn 1668) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
PolyPeptide Laboratories
inactive negative control peptide ![]() Inactive Negative Control Peptide, supplied by PolyPeptide Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/inactive negative control peptide/product/PolyPeptide Laboratories Average 90 stars, based on 1 article reviews
inactive negative control peptide - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
inactive control peptide (2 mm) ![]() Inactive Control Peptide (2 Mm), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/inactive control peptide (2 mm)/product/GenScript corporation Average 90 stars, based on 1 article reviews
inactive control peptide (2 mm) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Upstate Biotechnology Inc
the control inactive reporter fopflash ![]() The Control Inactive Reporter Fopflash, supplied by Upstate Biotechnology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/the control inactive reporter fopflash/product/Upstate Biotechnology Inc Average 90 stars, based on 1 article reviews
the control inactive reporter fopflash - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: The Journal of Neuroscience
Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories
doi: 10.1523/JNEUROSCI.3333-15.2016
Figure Lengend Snippet: Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: G2CT). C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
Article Snippet: The
Techniques:
Journal: The Journal of Neuroscience
Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories
doi: 10.1523/JNEUROSCI.3333-15.2016
Figure Lengend Snippet: Interfering with AP2-dependent GluA2/AMPAR removal and delayed onset of GluA23Y infusions prevent forgetting of long-term object location memories. A–C, Inhibiting AP2-dependent synaptic removal of GluA2/AMPARs prevents forgetting (see Fig. 8B for cannula placements). A, Animals were trained as before (Fig. 1D), but instead of GluA23Y, the peptide G2CT (n = 7, inactive control peptide, Ctrl, n = 7) was infused to interfere with the binding of AP2 to GluA2 to attenuate activity-dependent synaptic removal of GluA2/AMPARs. B, Only animals infused with G2CT preferred exploring the object at the new location, expressing significantly stronger novelty preference than the animals infused with the inactive control peptide (Ctrl). C, There were no group differences in exploratory activity. D–F, Infusing GluA23Y can prolong remote memories shortly before they would be naturally forgotten (see Fig. 8C for cannula placements). D, Seven days after the last training session (i.e., on day 8 after training), shortly before rats normally would forget the location memory (see Fig. 1A–C), animals received GluA23Y infusions into the dorsal hippocampus twice daily for 6 d. Twenty-four hours after the last infusion (or 14 d after the end of training), memory for object location was assessed by moving one of the objects to a novel location. E, Animals infused with GluA23Y (n = 7) preferred to explore the object at the new location, whereas animals that had received the inactive control variant (Ctrl, n = 6) explored both objects for an equal amount of time. The group difference was significant. F, Exploratory activity was the same for both groups.
Article Snippet: The
Techniques: Binding Assay, Activity Assay, Expressing, Variant Assay
Journal: The Journal of Neuroscience
Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories
doi: 10.1523/JNEUROSCI.3333-15.2016
Figure Lengend Snippet: Exploratory behavior during training sessions
Article Snippet: The
Techniques:
Journal:
Article Title: c-Jun N-terminal kinase 1 interacts with and negatively regulates Wnt/?-catenin signaling through GSK3? pathway
doi: 10.1093/carcin/bgn239
Figure Lengend Snippet: Loss of JNK1 promoted β-catenin protein expression and β-catenin-mediated transcriptional activity of TCF. (A) β-Catenin protein expression was upregulated in JNK1−/− MEFs. Both MEFs were lysed and subjected to immunoblotting analysis detecting the expression of β-catenin and JNK1. β-Actin was used as loading control. (B) β-Catenin–TCF4 reporter activity was upregulated in JNK1−/− MEFs. JNK1+/+ and JNK1−/− MEFs were cotransfected with Renilla and a construct of TOPFLASH or FOPFLASH. Twenty-four hours after transfection, cells were treated with Wnt3a condition medium of 1:4 dilution for 24 h and harvested for luciferase activity assay.
Article Snippet: TCF-4 reporter plasmid TOPFLASH and the
Techniques: Expressing, Activity Assay, Western Blot, Construct, Transfection, Luciferase
Journal:
Article Title: c-Jun N-terminal kinase 1 interacts with and negatively regulates Wnt/?-catenin signaling through GSK3? pathway
doi: 10.1093/carcin/bgn239
Figure Lengend Snippet: Active JNK1 downregulated β-catenin expression and inhibited its transcriptional activity. (A) Active JNK1 reduced β-catenin protein level in HEK cell line HEK293T. HEK293T cells were cotransfected with pcDNA3-Flag-MKK7-JNK1 and pcDNA3-HA-β-catenin. Forty-eight hours after transfection, cells were harvested for immunoblotting analysis to detect the alterations of HA-β-catenin, p-JNK and p-c-Jun. β-Actin served as loading control. The density of band was quantified and the expression of β-catenin was normalized to β-actin. (B) Active JNK1 inhibited β-catenin-mediated transcriptional activity of TCF4. HEK293T cells were cotransfected with pcDNA3-Flag-MKK7-JNK1, pcDNA3-HA-β-catenin, TOPFLASH or FOPFLASH and a Renilla construct. Forty-eight hours after transfection, cells were harvested for luciferase activity assay. Each bar represents the mean ± SD for triplicate samples. Similar experiments were done in human colon cancer cell line SW480 (C and D). (E) Activated exogenous JNK1 reduced β-catenin protein level in a dose-dependent manner. HEK293T cells were cotransfected with pcDNA3-HA-β-catenin and different amounts of pcDNA3-Flag-MKK7-JNK1, as indicated. The protein was obtained for immunoblotting analysis to detect the alterations of HA-β-catenin and p-JNK. β-Actin served as loading control. (F) Activated exogenous JNK1 inhibited β-catenin-mediated transcriptional activity of TCF in a dose-dependent manner. HEK293T cells were cotransfected with pcDNA3-HA-β-catenin, TOPFLASH, Renilla, along with different amounts of pcDNA3-Flag-MKK7-JNK1, as indicated. Forty-eight hours after transfection, cells were harvested for luciferase activity assay. Each bar represents the mean ± SD for triplicate samples.
Article Snippet: TCF-4 reporter plasmid TOPFLASH and the
Techniques: Expressing, Activity Assay, Transfection, Western Blot, Construct, Luciferase